Tài liệu chuyên ngành xây dựng, khoa học kỹ thuât, máy móc...
Nội quy chuyên mục: - Hiện nay có khá nhiều trang chia sẻ Tài liệu nhưng mất phí, đó là lý do ket-noi mở ra chuyên mục Tài liệu miễn phí.

- Ai có tài liệu gì hay, hãy đăng lên đây để chia sẻ với mọi người nhé! Bạn chia sẻ hôm nay, ngày mai mọi người sẽ chia sẻ với bạn!
Cách chia sẻ, Upload tài liệu trên ket-noi

- Những bạn nào tích cực chia sẻ tài liệu, sẽ được ưu tiên cung cấp tài liệu khi có yêu cầu.
Nhận download tài liệu miễn phí
Hình đại diện của thành viên
By tctuvan
#976673 Link tải miễn phí luận văn
TRƯỜNG ĐẠI HỌC SƯ PHẠM HÀ NỘI
KHOA SINH HỌC

CHUYÊN ĐỀ SINH HỌC PHÂN TỬ

TÌM HIỀU VỀ
KỸ THUẬT PCR
(POLYMERASE CHAIN REACTION)



Giảng viên : GS. TS Nguyễn Thành Đạt
PGS.TS Đặng Hữu Lanh
Học viên : Ngô Như Hải
Lớp : Cao học K19
Chuyên ngành : Động vật học


HÀ NỘI, 3 – 2010


MỞ ĐẦU

Trong khoảng 3 thập kỷ qua nhân loại đã trải qua cuộc cách về mạng sinh học, những vấn đề sinh học phân tử (các quá trình lưu trữ, truyền đạt và biểu hiện thông tin di truyền ở mức độ phân tử) là một bộ phận trong cuộc cách mạng đó. Các kiến thức của sinh học phân tử cho phép chúng ta giải thích được mối quan hệ giữa cấu trúc và chức năng của các đại phân tử sinh học cũng như sự vận hành và kiểm soát các quá trình sinh hóa trong tế bào. Trọng tâm của sinh học phân tử là việc nghiên cứu các đại phân tử như ADN, ARN và Protein cùng các quá trình tái bản, phiên mã và dịch mã.
Trong số các tiến bộ kỹ thuật góp phần tạo ra các cuộc bùng nổ về lĩnh vực sinh học phân tử chúng ta phải kể tới kỹ thuật PCR (Polymerase Chain Reaction). Kỹ thuật PCR do Kary Mullis đề suất ra vào năm 1985, đây là phương pháp invitro để nhân bản nhanh một đoạn ADN nào đó, có độ nhạy rất cao chỉ cần một khối lượng ban đầu rất hạn chế. Bản thân kỹ thuật này chỉ là sự mở rộng trực tiếp các tính chất của quá trình tái bản ADN. Nhưng nó đã được sử dụng theo nhiều cách khác nhau để làm cho việc tách dòng và thao tác với ADN dễ dàng và hiệu quả hơn.
Vậy nguyên tắc, thành phần tham gia, điều kiện, các bước tiến hành , ứng dụng và hạn chế của kỹ thuật PCR như thế nào chúng ta cùng tìm hiểu sau đâ

Lịch sử
Phương pháp căn bản chạy PCR được Kary Mullis phát minh, ông đã đoạt giải Nobel về Hóa học vào tháng 10 năm 1993 cho thành tựu này, chỉ sau 7 năm khi ông đưa ra ý tưởng. Ý kiến của Mullis là phát triển một quy trình mà ADN có thể nhân lên nhiều lần một cách nhân tạo qua nhiều chu kỳ sao chép bởi enzyme ADN polymerase.
ADN polymerase có tự nhiên trong sinh vật sống, nơi mà nó thực hiện chức năng nhân ADN khi tế bào phân chia. Nó làm việc bằng cách nối với sợi ADN và tạo sợi bổ sung. Theo quy trình PCR gốc của Mullis, enzyme phản ứng nhân bản ADN được thực hiện trong ống nghiệm (in vitro). Sợi ADN đôi bị tách thành 2 sợi đơn khi đun nóng ở 96°C. Tuy nhiên, ở nhiệt độ này ADN polymerase bị phá hủy vì vậy cần bổ sung enzyme sau mỗi giai đoạn nung nóng của mỗi chu kỳ. Quy trình PCR gốc của Mullis không có hiệu quả cao vì nó mất nhiều thời gian, cần một lượng lớn ADN polymerase, và phải liên tục lưu ý suốt trong quá trình PCR.
Sau đó, quy trình gốc này được phát triển bằng cách dùng ADN-polymerase lấy từ vi khuẩn Thermus aquaticus (ưa nhiệt) sống trong mạch nước phun ở nhiệt độ trên 110°C. ADN polymerase từ sinh vật này là thermostable (ổn định ở nhiệt độ cao) và khi dùng trong PCR nó không bị phá vỡ khi hỗn hợp được nung nóng để tách sợi ADN. Từ đó, không cần thêm ADN-polymerase vào mỗi chu kỳ, quá trình sao chép ADN có thể đơn giản và tự động hơn.
Một trong những ADN-polymerase chịu nhiệt đầu tiên được phân lập được từ Thermus aquaticus và được gọi là Taq. Taq polymerase được dùng rộng rãi trong thực nghiệm PCR (5/2004). Nhược điểm của Taq là thỉnh thoảng nó nhầm lẫn trong quá trình sao chép ADN, dẫn đến đột biến (sai) trong chuỗi ADN, vì nó thiếu tính sửa sai exonuclease 3’-5’. Các polymerase như Pwo hay Pfu, được phân lập từ Archaea có cơ chế sửa sai (cơ chế kiểm tra lỗi sai) và có thể làm giảm một cách đáng kể số đột biến xảy ra trong chuỗi ADN được sao chép. Ngày nay, sự kết hợp giữa Taq và Pfu có thể cung cấp cả độ tin cậy cao lẫn sự nhân bản chính xác của ADN.
I. Khái niệm chung
Kỹ thuật PCR (phản ứng chuỗi trùng hợp - Polymerase Chain Reaction) là phương pháp in vitro để nhân bản nhanh một đoạn AND nào đó, có độ nhạy rất cao, mà chỉ cần một khối lượng mẫu ban đầu hạn chế.
II. Nguyên lý
Kỹ thuật tổng hợp ADN ngoài cơ thể cũng tuân thủ những nguyên tắc cơ bản của sao chép ADN trong cơ thể như: Đoạn cần nhân mở xoắn thành hai mạch đơn, cần có các cặp mồi (mồi xuôi, mồi ngược), cần nguyên liệu và điều kiện môi trường thích hợp và enzym ADN polymerase. Tuy nhiên kỹ thuật PCR có khác là dùng nhiệt độ cao (94oC) tháo xoắn thay cho helicase kết hợp với enzym AND polymerase chịu nhiệt và hệ thống điều nhiệt thích hợp cho từng giai đoạn phản ứng tổng hợp cùng với các đoạn mồi được thiết kế chủ động. Nhờ kỹ thuật PCR mà với một lượng nhỏ ADN ban đầu chúng ta có thể thu được đủ lượng ADN cần thiết để tiến hành các thí nghiệm về ADN.
III. Các điều kiện của phản ứng PCR
Muốn tiến hành phản ứng PCR cần có các thành phần sau:
- ADN khuôn.
- Mồi.
- ADN polymerase.
- Các deoxyribonucleotit triphosphat (dNTP).
- Dung dịch đệm (buffer).
1. ADN khuôn (template)
Gần như bất kỳ loại ADN, dù là mạch thẳng, mạch vòng, ADN plasmit, ADN hệ gen, cADN, hay ARN…đều có thể làm khuôn cho phản ứng PCR. ADN lấy từ nguồn nào không quan trọng yêu cầu duy nhất là vị trí gắn các mồi và trình tự giữa chúng còn nguyên vẹn đã có những mẫu ADN mà tuổi đến hơn 7 nghìn năm vẫn được sử dụng rất thành công trong các phản ứng PCR.
Chúng ta hãy xem xét việc nhân bội một phân tử ADN đích. Khi lượng phân tử ADN ban đầu nhỏ, sự nhiễm (có mặt ADN mà chúng ta không quan tâm) trở thành vấn đề chính. Đặc tính nhân bội của kỹ thuật PCR có nghĩa là, thậm chí chỉ nhiễm rất ít ADN cũng có thể phá hỏng thí nghiệm. Nhiễm có thể từ nhiều nguồn khác nhau, kể cả từ nhà nghiên cứu thực hiện thí nghiệm, từ ống nghiệm, từ đầu tip, thậm chí từ enzym và dung môi dùng cho thí nghiệm. Trong một thí nghiệm PCR điển hình, khoảng 0,1 - 1 g hệ gen được thêm vào phản ứng để có thể thực hiện PCR với số chu kỳ ít mà vẫn có đủ vật liệu cho các thí nghiệm tiếp theo. Điều đó cũng giúp giảm thiểu khả năng nguồn nhiễm đươc nhân bội. Lượng ADN này tương ứng với bao nhiêu bản sao trình tự đích? Nếu bạn thêm 1 g ADN hệ gen người thì nó tương ứng với 1 x 10-6/(6,4 x 109 x 650) = 2,4.10-19 mol. Vì ADN người chứa khoảng 6,4 x 109 bp và khối lượng phân tử trung bình của một cặp bazơ là 650 Da nên 1 g ADN người tương với 2,4 x 10-19mol x 6 x 1023 (số Avogadro) = khoảng 144.000 phân tử. Một đoạn ADN hệ gen dài 1000bp nhân bội 8 triệu lần (sau 25 chu kỳ PCR) sẽ sinh ra khoảng 10 g đoạn ADN đó. Lượng nhỏ đó đủ để nhận biết bằng cách nhuộm ethidium bromide sau khi điện di.
2. Mồi (primer)
Thành công của phản ứng PCR có hiệu quả cao hay không cơ bản phụ thuộc vào mồi.
Mồi gồm một mồi xuôi (sens primer) và một mồi ngược (antisens primer). Các cặp mồi cần được thiết kế để mồi này nhận biết được sợi có nghĩa của ADN mà ta cần tái bản, còn mồi kia nhận biết được sợi đối nghĩa. Các mồi có những đặc điểm sau:
- Dài khoảng 17 – 30 nucleotit.
- Có hàm lượng GC khoảng 50%.
- Nhiệt độ ở giai đoạn gắn mồi của từng cặp mồi (được tính từ phương trình 2(AT) + 4(GC)) trong mỗi thí nghiệm phải như nhau.
- Trình tự nucleotit phải đảm bảo mồi không gắn vào trình tự lặp lại trên ADN đích.
- Từng mồi không được chứa các đoạn trình tự bổ trợ. Ví dụ, mồi có trình tự 5’ – GAGATCGATGCATCGATCTC – 3’ có thể là mồi PCR tốt (vì dài 20 nucleotit, GC chiếm 50% và không chứa trình tự lặp lại) nhưng nó lại mang trình tự bổ trợ ở hai đầu và sẽ tạo cấu trúc cặp tóc nếu đầu 5’ gắn kết với đầu 3’. Khi đó phản ứng PCR sẽ không diễn ra.
- Hai mồi của cặp không được bổ trợ nhau hay đầu 3’ của hai mồi không được bổ trợ nhau. Ví dụ, hai mồi
5’ – GATCGATCGATACGTGATCC – 3’ và
5’ – CGTAGCTAGCTAGGATCACG – 3’ dường như là cặp mồi tốt. Tuy nhiên, các đầu 3’ của hai mồi lại bổ trợ nhau và có thể tạo primer dime rồi được tái bản trong chu kỳ 1 của phản ưng PCR:
5’ – GATCGATCGATACGTGATCC – 3’
3’ – GCACTAGGATCGATCGATGC – 5’

Link Download bản DOC
Password giải nén nếu cần: ket-noi.com | Bấm trực tiếp vào Link tải, không dùng IDM để tải:

Bấm vào đây để đăng nhập và xem link!

Xem thêm
Bài giảng Ứng dụng kỹ thuật PCR (polymerase chain reaction)
Hình đại diện của thành viên
By 29031980
#976735 Admin có biết tài liệu này sẽ giúp một người "đá phăng" cánh cửa giảng đường để "đâm thẳng" tới Lab không? Nếu không biết thì bây giờ Admin biết rồi đó. Nhận rổ cám của ơn này đi ㅠㅠ. :cry: :clapping:
Hình đại diện của thành viên
By tctuvan
#976752 Rất vui giúp được bạn. Chúc nghiên cứu khoa học hiệu quả đem lại giá trị mới cho xã hội nhé
Kết nối đề xuất:
Learn Synonym
Advertisement